ID: 1123139571

View in Genome Browser
Species Human (GRCh38)
Location 14:106062077-106062099
Sequence GGTCCCTTGGGACCACCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123139571_1123139584 1 Left 1123139571 14:106062077-106062099 CCCCCTGGTGGTCCCAAGGGACC No data
Right 1123139584 14:106062101-106062123 CTGCAGGGAGGTTTGTGTCTGGG No data
1123139571_1123139583 0 Left 1123139571 14:106062077-106062099 CCCCCTGGTGGTCCCAAGGGACC No data
Right 1123139583 14:106062100-106062122 CCTGCAGGGAGGTTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123139571 Original CRISPR GGTCCCTTGGGACCACCAGG GGG (reversed) Intergenic
No off target data available for this crispr