ID: 1123143258

View in Genome Browser
Species Human (GRCh38)
Location 14:106104277-106104299
Sequence GGGGAAAAGCAAATAAACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123143258_1123143266 23 Left 1123143258 14:106104277-106104299 CCCGTGTTTATTTGCTTTTCCCC No data
Right 1123143266 14:106104323-106104345 GGTTCAGGCTTCAGACCAATGGG No data
1123143258_1123143267 24 Left 1123143258 14:106104277-106104299 CCCGTGTTTATTTGCTTTTCCCC No data
Right 1123143267 14:106104324-106104346 GTTCAGGCTTCAGACCAATGGGG No data
1123143258_1123143268 25 Left 1123143258 14:106104277-106104299 CCCGTGTTTATTTGCTTTTCCCC No data
Right 1123143268 14:106104325-106104347 TTCAGGCTTCAGACCAATGGGGG No data
1123143258_1123143265 22 Left 1123143258 14:106104277-106104299 CCCGTGTTTATTTGCTTTTCCCC No data
Right 1123143265 14:106104322-106104344 TGGTTCAGGCTTCAGACCAATGG No data
1123143258_1123143264 8 Left 1123143258 14:106104277-106104299 CCCGTGTTTATTTGCTTTTCCCC No data
Right 1123143264 14:106104308-106104330 GTTTACTTGTTTGTTGGTTCAGG No data
1123143258_1123143263 2 Left 1123143258 14:106104277-106104299 CCCGTGTTTATTTGCTTTTCCCC No data
Right 1123143263 14:106104302-106104324 TGATTTGTTTACTTGTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123143258 Original CRISPR GGGGAAAAGCAAATAAACAC GGG (reversed) Intergenic
No off target data available for this crispr