ID: 1123144546

View in Genome Browser
Species Human (GRCh38)
Location 14:106116213-106116235
Sequence CTCAGGGCAGAGACCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123144546_1123144555 21 Left 1123144546 14:106116213-106116235 CCCATGGAGGTCTCTGCCCTGAG No data
Right 1123144555 14:106116257-106116279 AGGTTTCCCTGGGATTCCTCAGG No data
1123144546_1123144553 11 Left 1123144546 14:106116213-106116235 CCCATGGAGGTCTCTGCCCTGAG No data
Right 1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG No data
1123144546_1123144552 10 Left 1123144546 14:106116213-106116235 CCCATGGAGGTCTCTGCCCTGAG No data
Right 1123144552 14:106116246-106116268 AAACACTCTCCAGGTTTCCCTGG No data
1123144546_1123144551 1 Left 1123144546 14:106116213-106116235 CCCATGGAGGTCTCTGCCCTGAG No data
Right 1123144551 14:106116237-106116259 CTAACTGGAAAACACTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123144546 Original CRISPR CTCAGGGCAGAGACCTCCAT GGG (reversed) Intergenic