ID: 1123144551

View in Genome Browser
Species Human (GRCh38)
Location 14:106116237-106116259
Sequence CTAACTGGAAAACACTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123144547_1123144551 0 Left 1123144547 14:106116214-106116236 CCATGGAGGTCTCTGCCCTGAGT No data
Right 1123144551 14:106116237-106116259 CTAACTGGAAAACACTCTCCAGG No data
1123144543_1123144551 20 Left 1123144543 14:106116194-106116216 CCTGTTCTAATCAGAGATTCCCA No data
Right 1123144551 14:106116237-106116259 CTAACTGGAAAACACTCTCCAGG No data
1123144546_1123144551 1 Left 1123144546 14:106116213-106116235 CCCATGGAGGTCTCTGCCCTGAG No data
Right 1123144551 14:106116237-106116259 CTAACTGGAAAACACTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123144551 Original CRISPR CTAACTGGAAAACACTCTCC AGG Intergenic