ID: 1123144553

View in Genome Browser
Species Human (GRCh38)
Location 14:106116247-106116269
Sequence AACACTCTCCAGGTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123144546_1123144553 11 Left 1123144546 14:106116213-106116235 CCCATGGAGGTCTCTGCCCTGAG No data
Right 1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG No data
1123144547_1123144553 10 Left 1123144547 14:106116214-106116236 CCATGGAGGTCTCTGCCCTGAGT No data
Right 1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG No data
1123144543_1123144553 30 Left 1123144543 14:106116194-106116216 CCTGTTCTAATCAGAGATTCCCA No data
Right 1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG No data
1123144549_1123144553 -5 Left 1123144549 14:106116229-106116251 CCCTGAGTCTAACTGGAAAACAC No data
Right 1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG No data
1123144550_1123144553 -6 Left 1123144550 14:106116230-106116252 CCTGAGTCTAACTGGAAAACACT No data
Right 1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123144553 Original CRISPR AACACTCTCCAGGTTTCCCT GGG Intergenic