ID: 1123148043

View in Genome Browser
Species Human (GRCh38)
Location 14:106153502-106153524
Sequence AGGTCCCAGGAGCAGGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123148043_1123148055 14 Left 1123148043 14:106153502-106153524 CCCGGCACCTGCTCCTGGGACCT No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148043_1123148047 -7 Left 1123148043 14:106153502-106153524 CCCGGCACCTGCTCCTGGGACCT No data
Right 1123148047 14:106153518-106153540 GGGACCTGTCCCGCCCTCAGTGG No data
1123148043_1123148048 -6 Left 1123148043 14:106153502-106153524 CCCGGCACCTGCTCCTGGGACCT No data
Right 1123148048 14:106153519-106153541 GGACCTGTCCCGCCCTCAGTGGG No data
1123148043_1123148054 11 Left 1123148043 14:106153502-106153524 CCCGGCACCTGCTCCTGGGACCT No data
Right 1123148054 14:106153536-106153558 AGTGGGTCACGAGCGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123148043 Original CRISPR AGGTCCCAGGAGCAGGTGCC GGG (reversed) Intergenic
No off target data available for this crispr