ID: 1123148045

View in Genome Browser
Species Human (GRCh38)
Location 14:106153509-106153531
Sequence GCGGGACAGGTCCCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123148045_1123148061 27 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148045_1123148054 4 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148054 14:106153536-106153558 AGTGGGTCACGAGCGCCCCCTGG No data
1123148045_1123148060 26 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148060 14:106153558-106153580 GTGGCCCCGCGCGCCCCTGCAGG No data
1123148045_1123148055 7 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148045_1123148063 30 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148063 14:106153562-106153584 CCCCGCGCGCCCCTGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123148045 Original CRISPR GCGGGACAGGTCCCAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr