ID: 1123148046

View in Genome Browser
Species Human (GRCh38)
Location 14:106153515-106153537
Sequence CTGAGGGCGGGACAGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123148046_1123148060 20 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148060 14:106153558-106153580 GTGGCCCCGCGCGCCCCTGCAGG No data
1123148046_1123148054 -2 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148054 14:106153536-106153558 AGTGGGTCACGAGCGCCCCCTGG No data
1123148046_1123148055 1 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148046_1123148063 24 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148063 14:106153562-106153584 CCCCGCGCGCCCCTGCAGGGAGG No data
1123148046_1123148061 21 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123148046 Original CRISPR CTGAGGGCGGGACAGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr