ID: 1123148049

View in Genome Browser
Species Human (GRCh38)
Location 14:106153522-106153544
Sequence TGACCCACTGAGGGCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123148049_1123148061 14 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148049_1123148055 -6 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148049_1123148063 17 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148063 14:106153562-106153584 CCCCGCGCGCCCCTGCAGGGAGG No data
1123148049_1123148070 29 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148070 14:106153574-106153596 CTGCAGGGAGGTTTGTGTCCGGG No data
1123148049_1123148060 13 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148060 14:106153558-106153580 GTGGCCCCGCGCGCCCCTGCAGG No data
1123148049_1123148069 28 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148069 14:106153573-106153595 CCTGCAGGGAGGTTTGTGTCCGG No data
1123148049_1123148054 -9 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148054 14:106153536-106153558 AGTGGGTCACGAGCGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123148049 Original CRISPR TGACCCACTGAGGGCGGGAC AGG (reversed) Intergenic
No off target data available for this crispr