ID: 1123148055

View in Genome Browser
Species Human (GRCh38)
Location 14:106153539-106153561
Sequence GGGTCACGAGCGCCCCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123148045_1123148055 7 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148043_1123148055 14 Left 1123148043 14:106153502-106153524 CCCGGCACCTGCTCCTGGGACCT No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148046_1123148055 1 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148040_1123148055 19 Left 1123148040 14:106153497-106153519 CCTCTCCCGGCACCTGCTCCTGG No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148049_1123148055 -6 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data
1123148044_1123148055 13 Left 1123148044 14:106153503-106153525 CCGGCACCTGCTCCTGGGACCTG No data
Right 1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123148055 Original CRISPR GGGTCACGAGCGCCCCCTGG TGG Intergenic
No off target data available for this crispr