ID: 1123148061

View in Genome Browser
Species Human (GRCh38)
Location 14:106153559-106153581
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123148045_1123148061 27 Left 1123148045 14:106153509-106153531 CCTGCTCCTGGGACCTGTCCCGC No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148050_1123148061 9 Left 1123148050 14:106153527-106153549 CCCGCCCTCAGTGGGTCACGAGC No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148053_1123148061 4 Left 1123148053 14:106153532-106153554 CCTCAGTGGGTCACGAGCGCCCC No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148052_1123148061 5 Left 1123148052 14:106153531-106153553 CCCTCAGTGGGTCACGAGCGCCC No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148046_1123148061 21 Left 1123148046 14:106153515-106153537 CCTGGGACCTGTCCCGCCCTCAG No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148051_1123148061 8 Left 1123148051 14:106153528-106153550 CCGCCCTCAGTGGGTCACGAGCG No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data
1123148049_1123148061 14 Left 1123148049 14:106153522-106153544 CCTGTCCCGCCCTCAGTGGGTCA No data
Right 1123148061 14:106153559-106153581 TGGCCCCGCGCGCCCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123148061 Original CRISPR TGGCCCCGCGCGCCCCTGCA GGG Intergenic
No off target data available for this crispr