ID: 1123150206

View in Genome Browser
Species Human (GRCh38)
Location 14:106174441-106174463
Sequence CACTACGCACAGAAGTTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123150206_1123150209 -5 Left 1123150206 14:106174441-106174463 CCCCGGAACTTCTGTGCGTAGTG No data
Right 1123150209 14:106174459-106174481 TAGTGTGTGTTATCATTGTAAGG No data
1123150206_1123150213 30 Left 1123150206 14:106174441-106174463 CCCCGGAACTTCTGTGCGTAGTG No data
Right 1123150213 14:106174494-106174516 CAACCACTATGCCCTTGTCCAGG No data
1123150206_1123150210 -4 Left 1123150206 14:106174441-106174463 CCCCGGAACTTCTGTGCGTAGTG No data
Right 1123150210 14:106174460-106174482 AGTGTGTGTTATCATTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123150206 Original CRISPR CACTACGCACAGAAGTTCCG GGG (reversed) Intergenic
No off target data available for this crispr