ID: 1123150889

View in Genome Browser
Species Human (GRCh38)
Location 14:106180775-106180797
Sequence TCTCCAGATAGACCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123150889_1123150894 7 Left 1123150889 14:106180775-106180797 CCTGTGGGTGGTCTATCTGGAGA No data
Right 1123150894 14:106180805-106180827 GGGTAAAGGTGTTAGAGATTAGG No data
1123150889_1123150893 -7 Left 1123150889 14:106180775-106180797 CCTGTGGGTGGTCTATCTGGAGA No data
Right 1123150893 14:106180791-106180813 CTGGAGAAGGTTCTGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123150889 Original CRISPR TCTCCAGATAGACCACCCAC AGG (reversed) Intergenic
No off target data available for this crispr