ID: 1123153350

View in Genome Browser
Species Human (GRCh38)
Location 14:106203122-106203144
Sequence CAGGCTCCTCTGTTGCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123153342_1123153350 11 Left 1123153342 14:106203088-106203110 CCGAGAGCAAGGGAGCCCTGGCC No data
Right 1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG No data
1123153340_1123153350 19 Left 1123153340 14:106203080-106203102 CCTGGGGGCCGAGAGCAAGGGAG No data
Right 1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG No data
1123153343_1123153350 -4 Left 1123153343 14:106203103-106203125 CCCTGGCCCCATCAATCATCAGG No data
Right 1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG No data
1123153346_1123153350 -10 Left 1123153346 14:106203109-106203131 CCCCATCAATCATCAGGCTCCTC No data
Right 1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG No data
1123153337_1123153350 28 Left 1123153337 14:106203071-106203093 CCATGGGCTCCTGGGGGCCGAGA No data
Right 1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG No data
1123153345_1123153350 -5 Left 1123153345 14:106203104-106203126 CCTGGCCCCATCAATCATCAGGC No data
Right 1123153350 14:106203122-106203144 CAGGCTCCTCTGTTGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123153350 Original CRISPR CAGGCTCCTCTGTTGCGGCC AGG Intergenic