ID: 1123155277

View in Genome Browser
Species Human (GRCh38)
Location 14:106218815-106218837
Sequence ATTTCTCTTTAACAGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123155274_1123155277 19 Left 1123155274 14:106218773-106218795 CCCATGGATGTTCGCTAAAAAGT No data
Right 1123155277 14:106218815-106218837 ATTTCTCTTTAACAGCATGAGGG No data
1123155275_1123155277 18 Left 1123155275 14:106218774-106218796 CCATGGATGTTCGCTAAAAAGTG No data
Right 1123155277 14:106218815-106218837 ATTTCTCTTTAACAGCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123155277 Original CRISPR ATTTCTCTTTAACAGCATGA GGG Intergenic
No off target data available for this crispr