ID: 1123158436

View in Genome Browser
Species Human (GRCh38)
Location 14:106252939-106252961
Sequence TGCAAGAATCACAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123158436_1123158441 -2 Left 1123158436 14:106252939-106252961 CCTTCCCCTTTGTGATTCTTGCA No data
Right 1123158441 14:106252960-106252982 CAAGATCTCACAAGGTCTCATGG No data
1123158436_1123158442 11 Left 1123158436 14:106252939-106252961 CCTTCCCCTTTGTGATTCTTGCA No data
Right 1123158442 14:106252973-106252995 GGTCTCATGGTTTAAAAGTGTGG No data
1123158436_1123158440 -10 Left 1123158436 14:106252939-106252961 CCTTCCCCTTTGTGATTCTTGCA No data
Right 1123158440 14:106252952-106252974 GATTCTTGCAAGATCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123158436 Original CRISPR TGCAAGAATCACAAAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr