ID: 1123158865

View in Genome Browser
Species Human (GRCh38)
Location 14:106257957-106257979
Sequence TTCAGTTACTACTACATGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123158865_1123158868 0 Left 1123158865 14:106257957-106257979 CCGCTCATGTAGTAGTAACTGAA No data
Right 1123158868 14:106257980-106258002 GGTGAATCCAGAGGCTGCACAGG No data
1123158865_1123158870 11 Left 1123158865 14:106257957-106257979 CCGCTCATGTAGTAGTAACTGAA No data
Right 1123158870 14:106257991-106258013 AGGCTGCACAGGAGAGTCTCAGG No data
1123158865_1123158871 12 Left 1123158865 14:106257957-106257979 CCGCTCATGTAGTAGTAACTGAA No data
Right 1123158871 14:106257992-106258014 GGCTGCACAGGAGAGTCTCAGGG No data
1123158865_1123158872 22 Left 1123158865 14:106257957-106257979 CCGCTCATGTAGTAGTAACTGAA No data
Right 1123158872 14:106258002-106258024 GAGAGTCTCAGGGACCCCCCAGG No data
1123158865_1123158867 -9 Left 1123158865 14:106257957-106257979 CCGCTCATGTAGTAGTAACTGAA No data
Right 1123158867 14:106257971-106257993 GTAACTGAAGGTGAATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123158865 Original CRISPR TTCAGTTACTACTACATGAG CGG (reversed) Intergenic
No off target data available for this crispr