ID: 1123161032

View in Genome Browser
Species Human (GRCh38)
Location 14:106277987-106278009
Sequence TGGCGAGTCCAGGAACTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123161023_1123161032 15 Left 1123161023 14:106277949-106277971 CCCTGGAGCTCCGGATCCACTGA No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data
1123161020_1123161032 21 Left 1123161020 14:106277943-106277965 CCCCTTCCCTGGAGCTCCGGATC No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data
1123161024_1123161032 14 Left 1123161024 14:106277950-106277972 CCTGGAGCTCCGGATCCACTGAT No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data
1123161027_1123161032 -1 Left 1123161027 14:106277965-106277987 CCACTGATACGGTCCAGACACAT No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data
1123161022_1123161032 19 Left 1123161022 14:106277945-106277967 CCTTCCCTGGAGCTCCGGATCCA No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data
1123161026_1123161032 5 Left 1123161026 14:106277959-106277981 CCGGATCCACTGATACGGTCCAG No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data
1123161021_1123161032 20 Left 1123161021 14:106277944-106277966 CCCTTCCCTGGAGCTCCGGATCC No data
Right 1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123161032 Original CRISPR TGGCGAGTCCAGGAACTGAT GGG Intergenic
No off target data available for this crispr