ID: 1123161904

View in Genome Browser
Species Human (GRCh38)
Location 14:106286881-106286903
Sequence CACCAGGAAGCGCCTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123161893_1123161904 29 Left 1123161893 14:106286829-106286851 CCTGGGAGGCCTGGGCGGAAGTT 0: 1
1: 0
2: 0
3: 23
4: 251
Right 1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG 0: 1
1: 0
2: 6
3: 18
4: 186
1123161895_1123161904 20 Left 1123161895 14:106286838-106286860 CCTGGGCGGAAGTTATGCAGGCC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG 0: 1
1: 0
2: 6
3: 18
4: 186
1123161898_1123161904 -1 Left 1123161898 14:106286859-106286881 CCTGGATCTTCCGGTCCAGCGCC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG 0: 1
1: 0
2: 6
3: 18
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123161904 Original CRISPR CACCAGGAAGCGCCTCCAGG TGG Intergenic
900370325 1:2329386-2329408 CTGCTGGAAGCGCCTCCAGGTGG - Intronic
900591570 1:3462590-3462612 CACGAGGAAGTGGTTCCAGGAGG + Intronic
900615761 1:3565031-3565053 CACCAGGACGCGGACCCAGGAGG + Intronic
901199339 1:7457844-7457866 CACCAAGAAGACCCGCCAGGTGG - Intronic
901231736 1:7645533-7645555 CTCCAAGAGGAGCCTCCAGGTGG - Intronic
904285553 1:29451345-29451367 CACCATCAAGACCCTCCAGGAGG + Intergenic
904289265 1:29473666-29473688 CCCCAGGAAGGGCCTGCAGATGG - Intergenic
905372045 1:37487550-37487572 TACCAGGAAGCACCGGCAGGTGG - Intergenic
905773378 1:40652822-40652844 CAGCAGGAAGAGCAGCCAGGAGG + Intronic
905848738 1:41257493-41257515 CACCAGGCAGGTTCTCCAGGCGG - Intergenic
907330664 1:53669212-53669234 CACCTGGAAACTCCTCTAGGTGG - Intronic
907336345 1:53702241-53702263 CACCAGGCTGCCTCTCCAGGAGG + Intronic
907442781 1:54489068-54489090 CGCCAGGAAGCGCCCCGGGGTGG - Intergenic
915393038 1:155561972-155561994 TACCGGGAAGTCCCTCCAGGCGG - Intronic
915409194 1:155687890-155687912 TACCGGGAAGTCCCTCCAGGCGG - Intronic
922412785 1:225392079-225392101 CACCAGGAGGCTCCTGCAGCTGG + Intronic
1062844848 10:696058-696080 CACCAAGCAGTGCGTCCAGGTGG + Intergenic
1063009473 10:2008273-2008295 CATCAAGAAGCGCCGCAAGGTGG - Intergenic
1067711688 10:48655826-48655848 CACCTGGCAGCGCCCCGAGGTGG + Intronic
1069630571 10:69894891-69894913 CACCCGGACCAGCCTCCAGGAGG - Intronic
1072695254 10:97598818-97598840 CAGCAGTGAGCGCCTCGAGGTGG + Exonic
1072909271 10:99485372-99485394 CACTAGAAAAGGCCTCCAGGTGG + Intergenic
1074921662 10:118020523-118020545 CACCGGGAGGCACCTCCAAGAGG + Intronic
1075074454 10:119341531-119341553 CACCAGGGAGGGCTTCCTGGAGG - Intronic
1076345841 10:129778434-129778456 CTCCAGGAAGCTCCACGAGGAGG - Intergenic
1076871999 10:133198915-133198937 CCCCCGGAAGCAACTCCAGGTGG - Exonic
1076889272 10:133276002-133276024 GAGCAGGAAGTGCCTCCCGGAGG + Intronic
1079005420 11:16788546-16788568 CGCCAGGAAGCGCCACCAGGGGG + Exonic
1079041406 11:17063593-17063615 CACCAGGAAGCCCCACCAGAGGG - Intergenic
1081455963 11:43223140-43223162 CACCAGGCAGCTCCTCAAGCAGG + Intergenic
1081658380 11:44873019-44873041 CACCAGGGAGGGCTTCCTGGAGG + Intronic
1090429580 11:126634829-126634851 CACCAGCAAGGGCCTCCGAGAGG - Intronic
1092140863 12:6182536-6182558 CAGCAGAAAAAGCCTCCAGGCGG + Intergenic
1096665514 12:53161308-53161330 CATCAGCAATTGCCTCCAGGGGG + Exonic
1101479843 12:105085720-105085742 CAGAAAAAAGCGCCTCCAGGAGG - Intergenic
1103000964 12:117384983-117385005 CAGCAGGCAGCCCCTCCCGGCGG + Intronic
1103506524 12:121444959-121444981 CCAGAGGAAGCGCCTCCAGGTGG - Intronic
1103554037 12:121755195-121755217 TACCAAGAAGGGCCTCCGGGTGG - Intronic
1104619431 12:130299808-130299830 CAGCAGGAAGAGCCACAAGGAGG - Intergenic
1104808998 12:131609196-131609218 TTCCAGGACGGGCCTCCAGGGGG + Intergenic
1104916903 12:132270318-132270340 CACCAGGAACCTCCTCCAGAAGG + Intronic
1107070079 13:36259303-36259325 AACCAAGAAGCGCTTCCTGGGGG - Intronic
1107661372 13:42643067-42643089 CACCAGGCAGGGCCTCCCTGTGG - Intergenic
1110821827 13:79925938-79925960 CACCAGGCAGGGCCTCCCTGTGG - Intergenic
1111380060 13:87438265-87438287 ACCCAGGAAGCACATCCAGGAGG - Intergenic
1111830357 13:93321868-93321890 CACCAGAAAGCCCATCCAGCAGG - Intronic
1112562349 13:100525848-100525870 CCCCAGGAAGCTCCTCCACCTGG + Intronic
1113343550 13:109450459-109450481 TACCAGAAATTGCCTCCAGGAGG - Intergenic
1119425722 14:74533646-74533668 CACAAGGAAGGGCGTTCAGGAGG - Intronic
1121355017 14:93207065-93207087 CACCGGGAAGCGCCACCCGGAGG + Exonic
1121568304 14:94927024-94927046 CATCAGGAGGGGCTTCCAGGAGG - Intergenic
1121775615 14:96588625-96588647 CTGCAGGAAGTGGCTCCAGGAGG - Intergenic
1122157085 14:99756184-99756206 CCCCAGGAGGCGACTGCAGGTGG + Intronic
1122666352 14:103333414-103333436 CACCACGAAGCGCCTTCAGGAGG + Intergenic
1123161903 14:106286880-106286902 CACCTGGAGGCGCTTCCTGGTGG - Intergenic
1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG + Intergenic
1123451047 15:20358794-20358816 CCCCAGGAAGCCCCTCCAGGGGG - Intergenic
1127670161 15:61187440-61187462 AAGGAGGAAGAGCCTCCAGGGGG + Intronic
1128145865 15:65332232-65332254 CACCTGGAGGAGTCTCCAGGGGG - Intronic
1128601732 15:69000772-69000794 TAGCAGGAGGGGCCTCCAGGAGG + Intronic
1128998179 15:72312173-72312195 CATCAGGAAGAGGCTGCAGGAGG + Intronic
1131048322 15:89330179-89330201 CACCAGTAGGGACCTCCAGGGGG + Exonic
1132280271 15:100607702-100607724 CCACAGGTAGCACCTCCAGGTGG - Intronic
1132311668 15:100862044-100862066 CTCCAGGAAGAGGCTCCAGAGGG + Intergenic
1132330482 15:101009010-101009032 CGCCAGGCAGCTCCCCCAGGTGG - Exonic
1133325791 16:4941392-4941414 CACCAGGAAGACCCTGCAGCTGG + Intronic
1133341136 16:5037008-5037030 CAGCAGGAAGAGCCACCTGGTGG + Intronic
1136177166 16:28525148-28525170 GACCAGGAAAGGCCTCCTGGAGG - Intergenic
1136220049 16:28823070-28823092 CGCGAGGAAGCGCCGCGAGGCGG - Intronic
1138104451 16:54280235-54280257 CAGCAGGAACCCCTTCCAGGAGG + Intergenic
1142027820 16:87823919-87823941 CACCCTGAAGCTCCTCCAGCCGG - Intergenic
1142894234 17:2964043-2964065 CCCCAGGAAGTGCCTCCGGTAGG - Exonic
1144101886 17:11948862-11948884 CAGCATGGAGCCCCTCCAGGAGG + Intronic
1145826291 17:27879587-27879609 CTCCAAGAAGCCCCTGCAGGAGG - Intronic
1145976736 17:28988267-28988289 CACTAGGAAGTGCCCCCAGGAGG - Intronic
1145994418 17:29097279-29097301 CACCAAGAAACGGCTCCAGCAGG - Exonic
1146474524 17:33152407-33152429 CACCAGGAAAAGCTTCAAGGTGG + Intronic
1148871995 17:50663716-50663738 CACCAGGAAGCCCCACCAGGAGG - Exonic
1149555219 17:57568820-57568842 CACCAAGGTGGGCCTCCAGGGGG + Intronic
1152058266 17:78049722-78049744 CACCAGGAAGGCCTTGCAGGTGG - Exonic
1152112577 17:78365480-78365502 CAGCAGGCAGGGCTTCCAGGAGG - Intergenic
1152230900 17:79113559-79113581 TCCCAGGAAGCGTGTCCAGGTGG - Intronic
1152462053 17:80446680-80446702 CACCAGGCAGCCTCTCCTGGAGG - Intergenic
1152521376 17:80858690-80858712 CGCCAGGAAGGGCCTTGAGGGGG + Intronic
1152905767 17:82970157-82970179 CATCAGGAAGAGCCCCGAGGGGG + Intronic
1157490051 18:48116774-48116796 AACCAGGAAGGGCCTCCTAGAGG - Intronic
1157504839 18:48218937-48218959 CTCTAGGGAGAGCCTCCAGGGGG - Intronic
1157682439 18:49617481-49617503 CACCAGGAAGGGCACCCAGGAGG - Intergenic
1159958573 18:74537773-74537795 GACCAGGAAGCTCCTCTGGGGGG + Intronic
1160855190 19:1214110-1214132 GAACAGGAAGAGCCTCCAGGAGG - Intronic
1161025639 19:2035449-2035471 GACCAGGAAGGGCTTCCTGGAGG - Intergenic
1161852085 19:6742883-6742905 CCCCAGGACGCACCTCCAGGTGG - Intronic
1162101650 19:8342781-8342803 CTACAGGAAGCGCCGCCGGGCGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162899291 19:13785110-13785132 CACCAGGAGGCGCCTCTAACCGG + Intergenic
1163801428 19:19368057-19368079 CATCTGGAAGCACATCCAGGAGG + Intergenic
1165483873 19:36083570-36083592 CACCAGGACCCTCCTCCAGCTGG - Intronic
1165916703 19:39265177-39265199 CGCCGGGAAGCAGCTCCAGGCGG - Intergenic
1166918009 19:46209005-46209027 CACCAGGAATGGCTTCCTGGAGG - Intergenic
926697945 2:15783888-15783910 CACCAGGAAGAGCTTCCTGCAGG - Intergenic
929823644 2:45292950-45292972 CACCTGGAAGTGCTGCCAGGAGG - Intergenic
935237792 2:101152426-101152448 CTCAGGGAAGCGCCTCCAGAAGG + Intronic
935332507 2:101987465-101987487 CACCTGGCAGGGCCTCCAGCAGG - Intergenic
935952641 2:108345080-108345102 CACCAGGCAGGGCCTCCCTGTGG - Intergenic
937369076 2:121285267-121285289 CCCCAGGAAGCGCGGCCCGGAGG + Intergenic
939075761 2:137600778-137600800 CATCAGGCAGCTCCTTCAGGAGG + Intronic
942540712 2:177012655-177012677 CACCGGGAAGCAGCTCCATGAGG + Intergenic
943626193 2:190202749-190202771 CACAACAAAGAGCCTCCAGGTGG + Exonic
947178107 2:227387848-227387870 CACCCGGTAGCACCTGCAGGTGG + Intergenic
947197957 2:227587402-227587424 CACCCGGTAGCACCTGCAGGTGG + Intergenic
947199131 2:227599068-227599090 CACCCGGTAGCACCTGCAGGTGG - Intergenic
947201003 2:227614703-227614725 CACCCGGTAGCACCTGCAGGTGG + Intronic
947201389 2:227617628-227617650 CACCCGGTAGCACCTGCAGGTGG - Intronic
947206603 2:227666874-227666896 CACCCGGTAGCACCTGCAGGTGG - Intergenic
947212945 2:227724629-227724651 CACCCGGTAGCACCTGCAGGTGG + Intergenic
947213439 2:227728438-227728460 CACCCGGTAGCACCTGCAGGTGG - Intergenic
947215479 2:227746015-227746037 CACCCGGTAGCACCTGCAGGTGG - Intergenic
947716051 2:232339351-232339373 CACCCAGCAGCGCCGCCAGGAGG + Intronic
948789781 2:240371288-240371310 CACCAGGGAGGGCCTCTGGGAGG + Intergenic
1168991768 20:2102116-2102138 CCCCAGGCAGGGGCTCCAGGGGG + Exonic
1171376278 20:24696234-24696256 AACCAGGAAATGCTTCCAGGAGG + Intergenic
1174574970 20:51530796-51530818 AAACAGGGAGGGCCTCCAGGAGG - Intronic
1175497630 20:59425749-59425771 CATCAGCAATCCCCTCCAGGAGG - Intergenic
1176243523 20:64085951-64085973 CACCAGGAAGGGCCTTCCTGGGG - Intronic
1179540286 21:42079322-42079344 CTCCAGGAAGCGCCTCTTGTTGG + Intronic
1180714082 22:17859688-17859710 CGCCTGGCAGAGCCTCCAGGCGG + Intronic
1181313097 22:21956055-21956077 CTCCAGGAAGGGGGTCCAGGGGG + Intergenic
1181346202 22:22222127-22222149 CTCCAGGAAGGGGGTCCAGGTGG + Intergenic
1182109205 22:27710958-27710980 TACCAGGAAGGGCTTCCTGGAGG - Intergenic
1184080106 22:42213327-42213349 CCCCAGCCAGAGCCTCCAGGAGG - Exonic
1184471241 22:44697572-44697594 CACCAGGCTTCGCCACCAGGGGG + Intronic
1184477509 22:44729599-44729621 CCCCAGGAAGTTCCTCCAGGCGG - Intronic
1184583876 22:45434766-45434788 CACCAGGCAGGGCCACCATGCGG + Intergenic
950146456 3:10653476-10653498 AACCAGGCAGGGCCTCAAGGGGG + Intronic
952303203 3:32122714-32122736 GACCAGGTATGGCCTCCAGGTGG - Intronic
954468990 3:50675362-50675384 CACGAGGATGCGAATCCAGGCGG - Intronic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
961270318 3:125683115-125683137 CTCCAAGAAGAGCCCCCAGGTGG - Intergenic
961385840 3:126523052-126523074 CAGCAGTAAGCGGCACCAGGTGG + Intergenic
961821467 3:129577678-129577700 ACCCAGGACGCGCCTCCAGGAGG + Intronic
969009501 4:4050100-4050122 CAACTTGAATCGCCTCCAGGTGG - Intergenic
969292643 4:6250582-6250604 CACAGGGAAGCGCCTCCTGTGGG + Intergenic
979794285 4:124827043-124827065 CCTCAGGAAGCTCCTTCAGGAGG + Intergenic
983614919 4:169692699-169692721 CACCAGACACTGCCTCCAGGAGG - Intronic
992690758 5:79237661-79237683 GGCCAGGAAGCGCATCCAGGAGG + Exonic
994344147 5:98664825-98664847 CACCAGGTAGAGCCTCCCTGTGG + Intergenic
997364405 5:133316524-133316546 CTCCCAGAAGCGCCTCCTGGTGG - Exonic
997364406 5:133316525-133316547 CACCAGGAGGCGCTTCTGGGAGG + Exonic
999171355 5:149597934-149597956 CATCAGGAGCCGCCTCCAGCAGG + Exonic
999504383 5:152179952-152179974 CACCAGGCAGTGCCCCCAGTGGG + Intergenic
999938586 5:156515951-156515973 CACCAGGCAGGGCCTCCCTGTGG + Intronic
1000407499 5:160904038-160904060 CATCAGGAAGCCCCCTCAGGTGG - Intergenic
1001452641 5:171838145-171838167 CACCAGGGAGCCCGCCCAGGAGG + Intergenic
1001991060 5:176115603-176115625 CACCAGGAAGGGCCCCGACGTGG + Intronic
1002200814 5:177527049-177527071 CACCAGGGAGTGCTTCCTGGAGG + Intronic
1002225811 5:177722537-177722559 CACCAGGAAGGGCCCCGACGTGG - Intronic
1002268039 5:178048675-178048697 CACCAGGAAGGGCCCCGACGTGG + Intronic
1002424577 5:179167590-179167612 CAGCAGGCAGAGCCTCCTGGCGG - Intronic
1004551568 6:16653170-16653192 CACCAGCAAGGGCATTCAGGAGG + Intronic
1005947534 6:30605225-30605247 GACCAGGAAGCACATGCAGGAGG + Intronic
1006171297 6:32094992-32095014 CACCTGGAACTTCCTCCAGGAGG + Intronic
1007425176 6:41741955-41741977 CACCAGGAAGCCTGTCCAAGGGG + Intronic
1018590713 6:165418491-165418513 CACCAGGACCCGCCTCCTGAAGG - Intronic
1018707189 6:166471386-166471408 CCTCAGAAAGCGCCTCTAGGTGG + Intronic
1019073943 6:169371620-169371642 CACCAGGAAGGGCCCTGAGGGGG + Intergenic
1019080073 6:169424455-169424477 TAGGAGGAAGCGCCTCCAGCAGG - Intergenic
1019493134 7:1324354-1324376 CCCCGGGAAGCGCCTCCCTGGGG + Intergenic
1020619117 7:10496941-10496963 CACCAGGCAGGGCCTCCCTGTGG + Intergenic
1029679304 7:102097021-102097043 CACCAGGTAGCAGCCCCAGGAGG - Intronic
1032683698 7:134209997-134210019 AAGCAGGCAGCTCCTCCAGGAGG + Intronic
1034076380 7:148235594-148235616 CACAAGGAAGAGCCTCCCAGAGG - Intronic
1034099052 7:148436101-148436123 CACCAGGAAGAGCCAGCATGGGG + Intergenic
1034540640 7:151755931-151755953 CACCATGAGGTTCCTCCAGGAGG + Intronic
1035160265 7:156944818-156944840 CACCAGGGCCCGCCTTCAGGCGG + Intergenic
1035977073 8:4324524-4324546 CACCAGAATGCACCTCCTGGGGG - Intronic
1036600981 8:10259899-10259921 CACCAGGGAGAGCCTACAGAGGG - Intronic
1037511290 8:19585958-19585980 CAGCAGGCAGAGCCCCCAGGAGG + Intronic
1037556877 8:20033604-20033626 CAGCAATAAGGGCCTCCAGGCGG + Intergenic
1038245975 8:25856702-25856724 CACCAGACACCACCTCCAGGAGG + Intronic
1041306777 8:56469916-56469938 GACCAGGCAGCACCTCCAGCAGG - Intergenic
1043471691 8:80569315-80569337 CACCAGGAAGCCCCACCAGGAGG - Intergenic
1043921354 8:85987362-85987384 TAGCAGGGAGCGCCTTCAGGAGG - Intronic
1045335957 8:101205099-101205121 GACCAAGACGCGCCTCCTGGAGG + Exonic
1047184607 8:122621241-122621263 TTCCGGGAAGCTCCTCCAGGCGG - Intergenic
1048521285 8:135157743-135157765 CCCCAAAAAGGGCCTCCAGGTGG + Intergenic
1049388711 8:142357341-142357363 CCCAAGGAAGCGGCTCAAGGGGG + Intronic
1049659380 8:143812892-143812914 CAGCAGGCAGCTCCTCCAGCCGG + Exonic
1049796255 8:144498543-144498565 CACCATGAAGGGCCTGCAGGTGG + Intronic
1049946856 9:605431-605453 CATCAGGAAGGGCTTCCTGGAGG + Intronic
1050952452 9:11615175-11615197 CACCAGGCAGATCCTTCAGGAGG - Intergenic
1053300526 9:36946056-36946078 CATCAGGAAGCGACTCCCTGAGG + Intronic
1053300533 9:36946104-36946126 CATCAGGAAGCGACTCCCTGAGG + Intronic
1053300539 9:36946152-36946174 CATCAGGAAGCGACTCCCTGAGG + Intronic
1055623747 9:78151126-78151148 CGTCAGGAAGCGCCCGCAGGTGG + Intergenic
1056301456 9:85246199-85246221 CAACAGGAAGATCCTCCTGGAGG + Intergenic
1056577436 9:87867269-87867291 CATCAGGGAGGGCCTCCAGGAGG + Intergenic
1056781197 9:89552660-89552682 CATCAGGAAGCTCCTCCAGGTGG - Intergenic
1059447695 9:114349043-114349065 CACCAGCAAGCGTCTCCCTGGGG - Intronic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1060604214 9:124899619-124899641 CAACAGGCAGAGCCTGCAGGGGG - Intronic
1061391397 9:130319180-130319202 TCCCAGGAAGCCCCTCCAAGGGG - Intronic
1062382932 9:136296308-136296330 CACCAGCAAGAGCCCCCAGGTGG - Intronic
1062461128 9:136662988-136663010 CCTCAGGAGGTGCCTCCAGGCGG + Intronic
1203773362 EBV:60315-60337 CACCAGGAGGCGCCTTCTGAGGG + Intergenic
1185465366 X:351212-351234 CACCGGGACGCCCTTCCAGGTGG - Intronic
1186155143 X:6717516-6717538 CACCACAAAGTGCTTCCAGGAGG - Intergenic
1187442553 X:19333122-19333144 CACCAGAAAGAGCCTCCAGCTGG + Intergenic
1187477822 X:19627363-19627385 CTCCAGGAAGCTTCTCCAGTTGG + Intronic
1196170314 X:112580082-112580104 GACCATGAAGCCCCTCCAGCTGG + Intergenic
1197424033 X:126273059-126273081 CACCAGGCAGCGCCTCCCTGCGG - Intergenic
1200125182 X:153810128-153810150 CAGCAGGAAGCACTTCTAGGAGG + Intronic