ID: 1123162086

View in Genome Browser
Species Human (GRCh38)
Location 14:106288091-106288113
Sequence GCCCCCTCCTCAGGATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123162086_1123162090 -3 Left 1123162086 14:106288091-106288113 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123162090 14:106288111-106288133 GGCCTAATCCAAGGAGAGAGAGG 0: 1
1: 4
2: 1
3: 12
4: 184
1123162086_1123162097 22 Left 1123162086 14:106288091-106288113 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123162097 14:106288136-106288158 CCGGGTCCTGTGGACACACACGG 0: 1
1: 0
2: 4
3: 19
4: 141
1123162086_1123162092 3 Left 1123162086 14:106288091-106288113 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123162092 14:106288117-106288139 ATCCAAGGAGAGAGAGGCTCCGG 0: 1
1: 0
2: 1
3: 36
4: 373
1123162086_1123162093 4 Left 1123162086 14:106288091-106288113 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123162093 14:106288118-106288140 TCCAAGGAGAGAGAGGCTCCGGG 0: 1
1: 4
2: 3
3: 43
4: 363
1123162086_1123162095 12 Left 1123162086 14:106288091-106288113 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123162095 14:106288126-106288148 GAGAGAGGCTCCGGGTCCTGTGG 0: 1
1: 0
2: 2
3: 25
4: 251
1123162086_1123162098 23 Left 1123162086 14:106288091-106288113 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123162098 14:106288137-106288159 CGGGTCCTGTGGACACACACGGG 0: 1
1: 0
2: 3
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123162086 Original CRISPR GCCCCCTCCTCAGGATTACA GGG (reversed) Intergenic
No off target data available for this crispr