ID: 1123163303

View in Genome Browser
Species Human (GRCh38)
Location 14:106301311-106301333
Sequence CCTGTTCTGCAGAGGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123163298_1123163303 9 Left 1123163298 14:106301279-106301301 CCTGGCAGGAAATGGCATCTCAG No data
Right 1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG No data
1123163297_1123163303 10 Left 1123163297 14:106301278-106301300 CCCTGGCAGGAAATGGCATCTCA No data
Right 1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123163303 Original CRISPR CCTGTTCTGCAGAGGTAGGG AGG Intergenic
No off target data available for this crispr