ID: 1123165999

View in Genome Browser
Species Human (GRCh38)
Location 14:106325213-106325235
Sequence TGGCGAGTCCAGGAACTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123165990_1123165999 18 Left 1123165990 14:106325172-106325194 CCACCAGGGAGCTCCGGATGCAC No data
Right 1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG No data
1123165987_1123165999 26 Left 1123165987 14:106325164-106325186 CCCTAAAGCCACCAGGGAGCTCC No data
Right 1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG No data
1123165993_1123165999 5 Left 1123165993 14:106325185-106325207 CCGGATGCACTGATACGGCCCAG No data
Right 1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG No data
1123165988_1123165999 25 Left 1123165988 14:106325165-106325187 CCTAAAGCCACCAGGGAGCTCCG No data
Right 1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG No data
1123165991_1123165999 15 Left 1123165991 14:106325175-106325197 CCAGGGAGCTCCGGATGCACTGA No data
Right 1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123165999 Original CRISPR TGGCGAGTCCAGGAACTGAT GGG Intergenic
No off target data available for this crispr