ID: 1123166131

View in Genome Browser
Species Human (GRCh38)
Location 14:106326769-106326791
Sequence CTGTTACTCCTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123166131_1123166138 20 Left 1123166131 14:106326769-106326791 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123166138 14:106326812-106326834 CAGAAACTGAAGAAATCAGTGGG No data
1123166131_1123166135 -3 Left 1123166131 14:106326769-106326791 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123166135 14:106326789-106326811 CAGCCTTATTCAAAAGGAAAAGG No data
1123166131_1123166137 19 Left 1123166131 14:106326769-106326791 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123166137 14:106326811-106326833 GCAGAAACTGAAGAAATCAGTGG No data
1123166131_1123166134 -9 Left 1123166131 14:106326769-106326791 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123166134 14:106326783-106326805 GAGTAACAGCCTTATTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123166131 Original CRISPR CTGTTACTCCTGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr