ID: 1123168826

View in Genome Browser
Species Human (GRCh38)
Location 14:106351804-106351826
Sequence CTGTTACTCCTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123168826_1123168832 19 Left 1123168826 14:106351804-106351826 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123168832 14:106351846-106351868 GCAGAAACTGAAGAAATCAGTGG No data
1123168826_1123168829 -9 Left 1123168826 14:106351804-106351826 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123168829 14:106351818-106351840 GAGTAACAGCCTTATTCAAAAGG No data
1123168826_1123168833 20 Left 1123168826 14:106351804-106351826 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123168833 14:106351847-106351869 CAGAAACTGAAGAAATCAGTGGG No data
1123168826_1123168830 -3 Left 1123168826 14:106351804-106351826 CCATCTTCCCTCAGGAGTAACAG No data
Right 1123168830 14:106351824-106351846 CAGCCTTATTCAAAAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123168826 Original CRISPR CTGTTACTCCTGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr