ID: 1123170873

View in Genome Browser
Species Human (GRCh38)
Location 14:106371736-106371758
Sequence CTGGACTCATGGAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123170873_1123170876 0 Left 1123170873 14:106371736-106371758 CCTTTTTTTCTCCATGAGTCCAG No data
Right 1123170876 14:106371759-106371781 CTCTTATATTCATATGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123170873 Original CRISPR CTGGACTCATGGAGAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr