ID: 1123170989

View in Genome Browser
Species Human (GRCh38)
Location 14:106372706-106372728
Sequence TTTGTTACACACACACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123170987_1123170989 -2 Left 1123170987 14:106372685-106372707 CCAAATAAAAGATAAGGGACATT No data
Right 1123170989 14:106372706-106372728 TTTGTTACACACACACACCAGGG No data
1123170984_1123170989 19 Left 1123170984 14:106372664-106372686 CCTATCGTCTATTTGTTATGTCC No data
Right 1123170989 14:106372706-106372728 TTTGTTACACACACACACCAGGG No data
1123170983_1123170989 29 Left 1123170983 14:106372654-106372676 CCAGCTGGTACCTATCGTCTATT No data
Right 1123170989 14:106372706-106372728 TTTGTTACACACACACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123170989 Original CRISPR TTTGTTACACACACACACCA GGG Intergenic
No off target data available for this crispr