ID: 1123179007

View in Genome Browser
Species Human (GRCh38)
Location 14:106450152-106450174
Sequence AGGTCCCAGCCAGAGCGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123179007_1123179012 11 Left 1123179007 14:106450152-106450174 CCTGCACGCTCTGGCTGGGACCT No data
Right 1123179012 14:106450186-106450208 ATGAACAGGAGTGGTTAGAGTGG No data
1123179007_1123179011 2 Left 1123179007 14:106450152-106450174 CCTGCACGCTCTGGCTGGGACCT No data
Right 1123179011 14:106450177-106450199 ATGACTATGATGAACAGGAGTGG No data
1123179007_1123179013 12 Left 1123179007 14:106450152-106450174 CCTGCACGCTCTGGCTGGGACCT No data
Right 1123179013 14:106450187-106450209 TGAACAGGAGTGGTTAGAGTGGG No data
1123179007_1123179009 -3 Left 1123179007 14:106450152-106450174 CCTGCACGCTCTGGCTGGGACCT No data
Right 1123179009 14:106450172-106450194 CCTCCATGACTATGATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123179007 Original CRISPR AGGTCCCAGCCAGAGCGTGC AGG (reversed) Intergenic
No off target data available for this crispr