ID: 1123180127

View in Genome Browser
Species Human (GRCh38)
Location 14:106461495-106461517
Sequence GCCCCCTCCTCAGGATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123180127_1123180130 2 Left 1123180127 14:106461495-106461517 CCCTGTAATCCTGAGGAGGGGGC No data
Right 1123180130 14:106461520-106461542 AATCCAAAGAGAGATGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123180127 Original CRISPR GCCCCCTCCTCAGGATTACA GGG (reversed) Intergenic
No off target data available for this crispr