ID: 1123180893

View in Genome Browser
Species Human (GRCh38)
Location 14:106469162-106469184
Sequence GATCTGAGCAGAGCCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123180892_1123180893 8 Left 1123180892 14:106469131-106469153 CCACTCTCAGGAGACGAACAAGC No data
Right 1123180893 14:106469162-106469184 GATCTGAGCAGAGCCACTGCTGG No data
1123180891_1123180893 16 Left 1123180891 14:106469123-106469145 CCTGTGCTCCACTCTCAGGAGAC No data
Right 1123180893 14:106469162-106469184 GATCTGAGCAGAGCCACTGCTGG No data
1123180889_1123180893 22 Left 1123180889 14:106469117-106469139 CCACGTCCTGTGCTCCACTCTCA No data
Right 1123180893 14:106469162-106469184 GATCTGAGCAGAGCCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123180893 Original CRISPR GATCTGAGCAGAGCCACTGC TGG Intergenic
No off target data available for this crispr