ID: 1123182450

View in Genome Browser
Species Human (GRCh38)
Location 14:106482654-106482676
Sequence GAGCCTTGACCTCAAAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123182450_1123182454 0 Left 1123182450 14:106482654-106482676 CCGCTGCTTTGAGGTCAAGGCTC No data
Right 1123182454 14:106482677-106482699 CTCGGTGGCAGCCACAGCAAAGG No data
1123182450_1123182459 26 Left 1123182450 14:106482654-106482676 CCGCTGCTTTGAGGTCAAGGCTC No data
Right 1123182459 14:106482703-106482725 CAGTGTCCGCCGCAGGGCAGAGG No data
1123182450_1123182457 20 Left 1123182450 14:106482654-106482676 CCGCTGCTTTGAGGTCAAGGCTC No data
Right 1123182457 14:106482697-106482719 AGGCTCCAGTGTCCGCCGCAGGG No data
1123182450_1123182460 30 Left 1123182450 14:106482654-106482676 CCGCTGCTTTGAGGTCAAGGCTC No data
Right 1123182460 14:106482707-106482729 GTCCGCCGCAGGGCAGAGGCCGG No data
1123182450_1123182456 19 Left 1123182450 14:106482654-106482676 CCGCTGCTTTGAGGTCAAGGCTC No data
Right 1123182456 14:106482696-106482718 AAGGCTCCAGTGTCCGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123182450 Original CRISPR GAGCCTTGACCTCAAAGCAG CGG (reversed) Intergenic
No off target data available for this crispr