ID: 1123183184

View in Genome Browser
Species Human (GRCh38)
Location 14:106489088-106489110
Sequence AGATGTACCTTTCATTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123183184_1123183188 25 Left 1123183184 14:106489088-106489110 CCTCCAAAATGAAAGGTACATCT No data
Right 1123183188 14:106489136-106489158 GTGTCTGCCTGGCTTGTCAGAGG No data
1123183184_1123183187 14 Left 1123183184 14:106489088-106489110 CCTCCAAAATGAAAGGTACATCT No data
Right 1123183187 14:106489125-106489147 AAAATATGTCTGTGTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123183184 Original CRISPR AGATGTACCTTTCATTTTGG AGG (reversed) Intergenic
No off target data available for this crispr