ID: 1123187895

View in Genome Browser
Species Human (GRCh38)
Location 14:106537738-106537760
Sequence GGTCCCTTGGGACCACCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123187895_1123187908 1 Left 1123187895 14:106537738-106537760 CCCCCTGGTGGTCCCAAGGGACC No data
Right 1123187908 14:106537762-106537784 CTGCAGGGAGGTTTGTGTCTGGG No data
1123187895_1123187907 0 Left 1123187895 14:106537738-106537760 CCCCCTGGTGGTCCCAAGGGACC No data
Right 1123187907 14:106537761-106537783 CCTGCAGGGAGGTTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123187895 Original CRISPR GGTCCCTTGGGACCACCAGG GGG (reversed) Intergenic
No off target data available for this crispr