ID: 1123189965

View in Genome Browser
Species Human (GRCh38)
Location 14:106559682-106559704
Sequence ACACGGATATTCATCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123189965_1123189976 19 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189976 14:106559724-106559746 GGTCATGGAGGCAGGGGAGATGG No data
1123189965_1123189971 4 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189971 14:106559709-106559731 ACGTGGTGCATTTCTGGTCATGG No data
1123189965_1123189973 11 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189973 14:106559716-106559738 GCATTTCTGGTCATGGAGGCAGG No data
1123189965_1123189974 12 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189974 14:106559717-106559739 CATTTCTGGTCATGGAGGCAGGG No data
1123189965_1123189970 -2 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189970 14:106559703-106559725 GTGGGCACGTGGTGCATTTCTGG No data
1123189965_1123189972 7 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189972 14:106559712-106559734 TGGTGCATTTCTGGTCATGGAGG No data
1123189965_1123189978 29 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189978 14:106559734-106559756 GCAGGGGAGATGGTTGGTTGAGG No data
1123189965_1123189977 23 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189977 14:106559728-106559750 ATGGAGGCAGGGGAGATGGTTGG No data
1123189965_1123189975 13 Left 1123189965 14:106559682-106559704 CCATCAGGGATGAATATCCGTGT No data
Right 1123189975 14:106559718-106559740 ATTTCTGGTCATGGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123189965 Original CRISPR ACACGGATATTCATCCCTGA TGG (reversed) Intergenic
No off target data available for this crispr