ID: 1123192298

View in Genome Browser
Species Human (GRCh38)
Location 14:106583020-106583042
Sequence TGGGCCAAACCCACCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123192298_1123192305 2 Left 1123192298 14:106583020-106583042 CCCTGATGGGTGGGTTTGGCCCA No data
Right 1123192305 14:106583045-106583067 AAGGCATCAATGGCTTTACTAGG No data
1123192298_1123192306 12 Left 1123192298 14:106583020-106583042 CCCTGATGGGTGGGTTTGGCCCA No data
Right 1123192306 14:106583055-106583077 TGGCTTTACTAGGCTTAGAGAGG No data
1123192298_1123192309 29 Left 1123192298 14:106583020-106583042 CCCTGATGGGTGGGTTTGGCCCA No data
Right 1123192309 14:106583072-106583094 GAGAGGGCCATGGCATAATTAGG No data
1123192298_1123192308 19 Left 1123192298 14:106583020-106583042 CCCTGATGGGTGGGTTTGGCCCA No data
Right 1123192308 14:106583062-106583084 ACTAGGCTTAGAGAGGGCCATGG No data
1123192298_1123192307 13 Left 1123192298 14:106583020-106583042 CCCTGATGGGTGGGTTTGGCCCA No data
Right 1123192307 14:106583056-106583078 GGCTTTACTAGGCTTAGAGAGGG No data
1123192298_1123192302 -8 Left 1123192298 14:106583020-106583042 CCCTGATGGGTGGGTTTGGCCCA No data
Right 1123192302 14:106583035-106583057 TTGGCCCAGGAAGGCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123192298 Original CRISPR TGGGCCAAACCCACCCATCA GGG (reversed) Intergenic
No off target data available for this crispr