ID: 1123192657

View in Genome Browser
Species Human (GRCh38)
Location 14:106586080-106586102
Sequence CAGGTGTCACTAATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123192657_1123192662 -1 Left 1123192657 14:106586080-106586102 CCTTTCTCCATTAGTGACACCTG No data
Right 1123192662 14:106586102-106586124 GCCTTAAGGGCGTTTGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123192657 Original CRISPR CAGGTGTCACTAATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr