ID: 1123193315

View in Genome Browser
Species Human (GRCh38)
Location 14:106592229-106592251
Sequence TTATGGATACTGATTGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123193315_1123193325 30 Left 1123193315 14:106592229-106592251 CCGCCCACAATCAGTATCCATAA No data
Right 1123193325 14:106592282-106592304 GTCCCTGTCCTTGGTCTGATAGG No data
1123193315_1123193318 -7 Left 1123193315 14:106592229-106592251 CCGCCCACAATCAGTATCCATAA No data
Right 1123193318 14:106592245-106592267 TCCATAAAGACTGTTCTAGACGG No data
1123193315_1123193322 8 Left 1123193315 14:106592229-106592251 CCGCCCACAATCAGTATCCATAA No data
Right 1123193322 14:106592260-106592282 CTAGACGGGGAACCTCACTGAGG No data
1123193315_1123193324 21 Left 1123193315 14:106592229-106592251 CCGCCCACAATCAGTATCCATAA No data
Right 1123193324 14:106592273-106592295 CTCACTGAGGTCCCTGTCCTTGG No data
1123193315_1123193321 -5 Left 1123193315 14:106592229-106592251 CCGCCCACAATCAGTATCCATAA No data
Right 1123193321 14:106592247-106592269 CATAAAGACTGTTCTAGACGGGG No data
1123193315_1123193320 -6 Left 1123193315 14:106592229-106592251 CCGCCCACAATCAGTATCCATAA No data
Right 1123193320 14:106592246-106592268 CCATAAAGACTGTTCTAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123193315 Original CRISPR TTATGGATACTGATTGTGGG CGG (reversed) Intergenic
No off target data available for this crispr