ID: 1123203580

View in Genome Browser
Species Human (GRCh38)
Location 14:106691608-106691630
Sequence GGGCATTCAGAACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123203580_1123203592 23 Left 1123203580 14:106691608-106691630 CCTGCTGGTGGTTCTGAATGCCC No data
Right 1123203592 14:106691654-106691676 TGGTTCTGAGTGCCCCCGAGTGG No data
1123203580_1123203585 0 Left 1123203580 14:106691608-106691630 CCTGCTGGTGGTTCTGAATGCCC No data
Right 1123203585 14:106691631-106691653 CCAGTGTCCTGAGCGCCCCCTGG No data
1123203580_1123203586 3 Left 1123203580 14:106691608-106691630 CCTGCTGGTGGTTCTGAATGCCC No data
Right 1123203586 14:106691634-106691656 GTGTCCTGAGCGCCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123203580 Original CRISPR GGGCATTCAGAACCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr