ID: 1123203647

View in Genome Browser
Species Human (GRCh38)
Location 14:106691895-106691917
Sequence AGCGCCCCCTGCAGGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123203640_1123203647 9 Left 1123203640 14:106691863-106691885 CCAGGTCATTCTGAGCTTCCCCT No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data
1123203637_1123203647 12 Left 1123203637 14:106691860-106691882 CCCCCAGGTCATTCTGAGCTTCC No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data
1123203642_1123203647 -9 Left 1123203642 14:106691881-106691903 CCCCTGGTGTCCTGAGCGCCCCC No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data
1123203643_1123203647 -10 Left 1123203643 14:106691882-106691904 CCCTGGTGTCCTGAGCGCCCCCT No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data
1123203635_1123203647 29 Left 1123203635 14:106691843-106691865 CCTGGTGGTTCTGAGTGCCCCCA No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data
1123203639_1123203647 10 Left 1123203639 14:106691862-106691884 CCCAGGTCATTCTGAGCTTCCCC No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data
1123203638_1123203647 11 Left 1123203638 14:106691861-106691883 CCCCAGGTCATTCTGAGCTTCCC No data
Right 1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123203647 Original CRISPR AGCGCCCCCTGCAGGTTCTG AGG Intergenic
No off target data available for this crispr