ID: 1123203817

View in Genome Browser
Species Human (GRCh38)
Location 14:106692639-106692661
Sequence AAGCTGAGGGGGCTCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123203817_1123203826 10 Left 1123203817 14:106692639-106692661 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123203826 14:106692672-106692694 TATTTTAAGGGAGACTGTGCTGG No data
1123203817_1123203823 -3 Left 1123203817 14:106692639-106692661 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123203823 14:106692659-106692681 CTTCCAAGTAGATTATTTTAAGG No data
1123203817_1123203827 17 Left 1123203817 14:106692639-106692661 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123203827 14:106692679-106692701 AGGGAGACTGTGCTGGTAATTGG No data
1123203817_1123203824 -2 Left 1123203817 14:106692639-106692661 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123203824 14:106692660-106692682 TTCCAAGTAGATTATTTTAAGGG No data
1123203817_1123203829 27 Left 1123203817 14:106692639-106692661 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123203829 14:106692689-106692711 TGCTGGTAATTGGTGTCCCTGGG No data
1123203817_1123203828 26 Left 1123203817 14:106692639-106692661 CCCTGTGAGAGCCCCCTCAGCTT No data
Right 1123203828 14:106692688-106692710 GTGCTGGTAATTGGTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123203817 Original CRISPR AAGCTGAGGGGGCTCTCACA GGG (reversed) Intergenic
No off target data available for this crispr