ID: 1123205257

View in Genome Browser
Species Human (GRCh38)
Location 14:106706627-106706649
Sequence CCTCCTGTGCACCAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123205253_1123205257 1 Left 1123205253 14:106706603-106706625 CCTGAGAGGAAACCTTCTCAGCA No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data
1123205249_1123205257 8 Left 1123205249 14:106706596-106706618 CCCAGCCCCTGAGAGGAAACCTT No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data
1123205246_1123205257 20 Left 1123205246 14:106706584-106706606 CCCAAAGGAAGACCCAGCCCCTG No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data
1123205247_1123205257 19 Left 1123205247 14:106706585-106706607 CCAAAGGAAGACCCAGCCCCTGA No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data
1123205252_1123205257 2 Left 1123205252 14:106706602-106706624 CCCTGAGAGGAAACCTTCTCAGC No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data
1123205250_1123205257 7 Left 1123205250 14:106706597-106706619 CCAGCCCCTGAGAGGAAACCTTC No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data
1123205251_1123205257 3 Left 1123205251 14:106706601-106706623 CCCCTGAGAGGAAACCTTCTCAG No data
Right 1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123205257 Original CRISPR CCTCCTGTGCACCAGCTGCA GGG Intergenic
No off target data available for this crispr