ID: 1123205736

View in Genome Browser
Species Human (GRCh38)
Location 14:106711373-106711395
Sequence GAGAGCACTGCAGAGCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123205736_1123205741 3 Left 1123205736 14:106711373-106711395 CCACGGGGCTCTGCAGTGCTCTC No data
Right 1123205741 14:106711399-106711421 TTGGGGGCATTTAAGCATCCTGG No data
1123205736_1123205743 27 Left 1123205736 14:106711373-106711395 CCACGGGGCTCTGCAGTGCTCTC No data
Right 1123205743 14:106711423-106711445 GAATAGTATTATCTCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123205736 Original CRISPR GAGAGCACTGCAGAGCCCCG TGG (reversed) Intergenic
No off target data available for this crispr