ID: 1123206070

View in Genome Browser
Species Human (GRCh38)
Location 14:106714761-106714783
Sequence GGGCAGAGTCACGATTACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123206070_1123206074 15 Left 1123206070 14:106714761-106714783 CCGCGGTAATCGTGACTCTGCCC No data
Right 1123206074 14:106714799-106714821 TAGTTTGCTGTACCAAAGATAGG No data
1123206070_1123206075 16 Left 1123206070 14:106714761-106714783 CCGCGGTAATCGTGACTCTGCCC No data
Right 1123206075 14:106714800-106714822 AGTTTGCTGTACCAAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123206070 Original CRISPR GGGCAGAGTCACGATTACCG CGG (reversed) Intergenic
No off target data available for this crispr