ID: 1123206075

View in Genome Browser
Species Human (GRCh38)
Location 14:106714800-106714822
Sequence AGTTTGCTGTACCAAAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123206070_1123206075 16 Left 1123206070 14:106714761-106714783 CCGCGGTAATCGTGACTCTGCCC No data
Right 1123206075 14:106714800-106714822 AGTTTGCTGTACCAAAGATAGGG No data
1123206073_1123206075 -5 Left 1123206073 14:106714782-106714804 CCTGGAACTTCTGTGCGTAGTTT No data
Right 1123206075 14:106714800-106714822 AGTTTGCTGTACCAAAGATAGGG No data
1123206072_1123206075 -4 Left 1123206072 14:106714781-106714803 CCCTGGAACTTCTGTGCGTAGTT No data
Right 1123206075 14:106714800-106714822 AGTTTGCTGTACCAAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123206075 Original CRISPR AGTTTGCTGTACCAAAGATA GGG Intergenic
No off target data available for this crispr