ID: 1123206991

View in Genome Browser
Species Human (GRCh38)
Location 14:106723489-106723511
Sequence CCTGTTCTGCAGAGGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123206983_1123206991 10 Left 1123206983 14:106723456-106723478 CCCTGGCAGGAAATGGCATCTCA No data
Right 1123206991 14:106723489-106723511 CCTGTTCTGCAGAGGTGGGGAGG No data
1123206984_1123206991 9 Left 1123206984 14:106723457-106723479 CCTGGCAGGAAATGGCATCTCAG No data
Right 1123206991 14:106723489-106723511 CCTGTTCTGCAGAGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123206991 Original CRISPR CCTGTTCTGCAGAGGTGGGG AGG Intergenic
No off target data available for this crispr