ID: 1123208564

View in Genome Browser
Species Human (GRCh38)
Location 14:106737362-106737384
Sequence GGGGCTGAGGTGAAGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208564_1123208576 27 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208576 14:106737412-106737434 GGTGCCTGTGGAGAAGAGAAAGG No data
1123208564_1123208570 0 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208570 14:106737385-106737407 AGACTGTACCAGCTGGACCTCGG No data
1123208564_1123208566 -7 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208566 14:106737378-106737400 CAGCCCCAGACTGTACCAGCTGG No data
1123208564_1123208572 6 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG No data
1123208564_1123208574 15 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208564_1123208571 5 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208571 14:106737390-106737412 GTACCAGCTGGACCTCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208564 Original CRISPR GGGGCTGAGGTGAAGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr