ID: 1123208565

View in Genome Browser
Species Human (GRCh38)
Location 14:106737375-106737397
Sequence GCTGGTACAGTCTGGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208565_1123208572 -7 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG No data
1123208565_1123208578 19 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208578 14:106737417-106737439 CTGTGGAGAAGAGAAAGGAGTGG No data
1123208565_1123208574 2 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208565_1123208571 -8 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208571 14:106737390-106737412 GTACCAGCTGGACCTCGGCGTGG No data
1123208565_1123208576 14 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208576 14:106737412-106737434 GGTGCCTGTGGAGAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208565 Original CRISPR GCTGGTACAGTCTGGGGCTG AGG (reversed) Intergenic
No off target data available for this crispr