ID: 1123208572

View in Genome Browser
Species Human (GRCh38)
Location 14:106737391-106737413
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208562_1123208572 8 Left 1123208562 14:106737360-106737382 CCCCAGGCTTCTTCACCTCAGCC No data
Right 1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG No data
1123208564_1123208572 6 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG No data
1123208563_1123208572 7 Left 1123208563 14:106737361-106737383 CCCAGGCTTCTTCACCTCAGCCC No data
Right 1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG No data
1123208565_1123208572 -7 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208572 Original CRISPR TACCAGCTGGACCTCGGCGT GGG Intergenic