ID: 1123208574

View in Genome Browser
Species Human (GRCh38)
Location 14:106737400-106737422
Sequence GACCTCGGCGTGGGTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208568_1123208574 -5 Left 1123208568 14:106737382-106737404 CCCAGACTGTACCAGCTGGACCT No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208563_1123208574 16 Left 1123208563 14:106737361-106737383 CCCAGGCTTCTTCACCTCAGCCC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208562_1123208574 17 Left 1123208562 14:106737360-106737382 CCCCAGGCTTCTTCACCTCAGCC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208564_1123208574 15 Left 1123208564 14:106737362-106737384 CCAGGCTTCTTCACCTCAGCCCC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208567_1123208574 -4 Left 1123208567 14:106737381-106737403 CCCCAGACTGTACCAGCTGGACC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208565_1123208574 2 Left 1123208565 14:106737375-106737397 CCTCAGCCCCAGACTGTACCAGC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data
1123208569_1123208574 -6 Left 1123208569 14:106737383-106737405 CCAGACTGTACCAGCTGGACCTC No data
Right 1123208574 14:106737400-106737422 GACCTCGGCGTGGGTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208574 Original CRISPR GACCTCGGCGTGGGTGCCTG TGG Intergenic
No off target data available for this crispr