ID: 1123208726

View in Genome Browser
Species Human (GRCh38)
Location 14:106738487-106738509
Sequence GCTCCAGGGAAGGGGCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208726_1123208732 -4 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208732 14:106738506-106738528 GAGCTCCAGATGCACTGATATGG No data
1123208726_1123208735 19 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208735 14:106738529-106738551 TCCAGACACATGGCGAGTCCAGG No data
1123208726_1123208738 29 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data
1123208726_1123208734 9 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208734 14:106738519-106738541 ACTGATATGGTCCAGACACATGG No data
1123208726_1123208737 28 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208737 14:106738538-106738560 ATGGCGAGTCCAGGAACTGATGG No data
1123208726_1123208739 30 Left 1123208726 14:106738487-106738509 CCAGGGAGCCCCTTCCCTGGAGC No data
Right 1123208739 14:106738540-106738562 GGCGAGTCCAGGAACTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208726 Original CRISPR GCTCCAGGGAAGGGGCTCCC TGG (reversed) Intergenic
No off target data available for this crispr