ID: 1123208730

View in Genome Browser
Species Human (GRCh38)
Location 14:106738501-106738523
Sequence TCAGTGCATCTGGAGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123208730_1123208735 5 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208735 14:106738529-106738551 TCCAGACACATGGCGAGTCCAGG No data
1123208730_1123208743 25 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208743 14:106738549-106738571 AGGAACTGATGGGGACTTTGGGG No data
1123208730_1123208739 16 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208739 14:106738540-106738562 GGCGAGTCCAGGAACTGATGGGG No data
1123208730_1123208742 24 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208742 14:106738548-106738570 CAGGAACTGATGGGGACTTTGGG No data
1123208730_1123208734 -5 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208734 14:106738519-106738541 ACTGATATGGTCCAGACACATGG No data
1123208730_1123208737 14 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208737 14:106738538-106738560 ATGGCGAGTCCAGGAACTGATGG No data
1123208730_1123208741 23 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208741 14:106738547-106738569 CCAGGAACTGATGGGGACTTTGG No data
1123208730_1123208738 15 Left 1123208730 14:106738501-106738523 CCCTGGAGCTCCAGATGCACTGA No data
Right 1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123208730 Original CRISPR TCAGTGCATCTGGAGCTCCA GGG (reversed) Intergenic
No off target data available for this crispr